J2 Haplogroup

Y DNA haplogroups E3b, J2 and G belonged to the early farmers that arrived in Europe from the Middle East, while haplogroup I represents the old farmers. To see the current charts, you need to go to the Haplotree tab on your FTDNA member page. The J Haplogroup Project will remain in place for some time, though without research on J1 and other terminal groups. The haplotypes of these Haplotype J2 Kohanim cluster under J2a4h (L24), not the J2a4b (M67) clade. Distribution Haplogroup J2 Y-DNA. Haplogroups are mtDNA sequence polymorphism variations that have occurred over more than 150 000 years and correlate with the geographic origins of populations traced through the maternal lineages. Haplogroup M is most prevalent in Melanesia. Ancient greek haplogroup Ancient greek haplogroup. Haplogroup J-M304 is divided into two main subclades (branches), J. For 18 years J2 Scientific has focused on automating the prep lab. From that link, " J2 is thought to have appeared somewhere in the Middle East towards the end of the last glaciation, between 15,000 and. Current Haplogropup J2 distribution Most Yanceys are J2. 112 registered by Afilias Global Registry Services network. White T-Shirt $19. and fry their brains until they are toast The Five Is work together and run the Q operation now. svg اذهب إلى التنقل اذهب إلى. Haplogroup J-M304, also known as J, [Phylogenetics 1] is a human Y-chromosome DNA haplogroup. There were several nearby Indo-European and non-Indo-European Caucasian peoples that were probably rich in both R1b and J2 that had intense interactions with Assyrians. Looking at the Y-DNA haplogroup frequencies by country it is easy to assume that J1 is a marker of Arabic ancestry because J1 reaches its maximum frequency in and around the Arabian peninsula. Discussion and support of Y-DNA. Site Rating. Article Toward a Sephardic Haplogroup Profile in the New World - Free download as PDF File (. Updated versions. 5% R1b-M269, 10% I2 (notably 6. Haplogroup L is mainly found in South Asia. Haplogroup J2 is a major West Asian and Greco-Roman paternal lineage. j2 Global's advanced International cloud services and digital media brands enable people to connect J2 Global's businesses are digital leaders in tech, health, communications, security, and martech. 1,6 K J’aime. If you know any SNP from this subclade you can use the SNP Lookup. (Excerpted from Genebase. R1a is also the predominant lineage among Cimmerians, Scy_Ukr and ScySar_SU in our data, and present among Scy_Kaz as. Haplogroup J2 (Q11024914). Miroslava Derenko mail, Boris Malyarchuk. See also haplograph. Haplogroup J1 separated from haplogroup J approximately 31. It is further divided into two complementary clades, J2a-M410 and J2b-M12. Haplogroup J2 is found frequently in Lebanon, Greece, Turkey (aboriginal not Seljuk), Italy, and the Caucus region 6,7,8,9,10. This thread is archived. (Y-DNA / Y-chromosome, not to be confused with mtDNA J2). Mehr von Haplogroup J2 auf Facebook anzeigen. Other European Y-DNA haplogroups include Haplogroup N2 (Finland and Russia), Q (Norway), G (central and southern Europe), J2 (the eastern Mediterranean and Ashkenazi Jews), and T. Cinnioglu et al. Maternal Haplogroup C. I used the same method as before. Mannis Van Oven. However, I am proving that the early settlers of America belong to haplogroup R1b1, and the they came from northwestern Europe, which is well over 80% R1b1, not the J1 or J2 groups of the Israelites, Jews and Arabs (Ishmaelites). Files are available under licenses specified on their description page. Other Y-DNA haplogroups reaching considerable frequencies among the Burusho are haplogroup J2, associated with the spread of agriculture in, and from, the neolithic Near East, and haplogroup C3. ↑ Comparative chronological tree of European Y-DNA & mtDNA haplogroups. x that provides significant improvements over its predecessor such as performance improvement, automatic reloading. evet test'e tabi tutunlar da bu bu kadar çıkmıştı. J2TEAM has 51 repositories available. Each build is a major update to the tree. The haplogroup is frequent near the southern Baltic and North Sea coasts, but almost non-existent outside of Europe. Haplogroup J1, which is also known as M267, is a subclade of Y-DNA haplogroup J-P209 (Haplogroup J). This haplogroup is the roo;t of all living human Y-DNA haplogroups except for haplogroup A. Haplogroup J2 is widely believed to be associated with the spread of agriculture from Mesopotamia. This blog is dedicated to those who carry the J2 "Y" DNA Haplogroup, with a focus on J2a4h2, also known as J-L25, with further changes to F3133, and FGC9962. Greco-Anatolian, Mesopotamian, Caucasian. Haplogroup J2. It is associated with many Bronze & Iron History and description of Haplogroup J2 (Y-chromosomal DNA) and its subclades. Y-DNA Haplogroup J2 YouTube Channel. x that provides significant improvements over its predecessor such as performance improvement, automatic reloading. The newly discovered haplogroup, Q1a3a4, designated by L400 and L401 is shown last on the list and is the new Native American haplogroup discovered thanks to Leonard Trujillo. Erle Stanley Gardner (July 17, 1889 – March 11, 1970) was an American lawyer and author, who belongs to haplogroup J2-Y66507. With J2TX Buy Crypto service you can easily exchange Fiat to Crypto using your credit card. Dissecting the in uence o f Neolithic demic di usion on Indian Y-chromosome pool through J2-M172 haplogroup. Follow their code on GitHub. Corresponding areas between Geno 2. J2 haplogrubu hakkında bilgi içeren yazı, J2 nedir ve nerelerde görülür, J2 nin görülme oranları, haplogroup J2 map ve J2 geni hakkında bilgi, m172. Seven Y chromosome major branches (E3b, G, J1, J2, Q, R1a1, and R1b) that are prevalent among Ashkenazi Jews. António de Macedo - born in Pico Haplogroup - J2. Cet haplogroupe se compose de trois principaux sous-clades, R1b-M269, très fréquent en Europe de l'Ouest, R1b-V88 qui se retrouve surtout dans certaines parties de l'Afrique subsaharienne et au Moyen-Orient et R1b-M73 qui se rencontre en Asie du sud et de l'ouest. 2 but I am pretty confident about this. R1a1 Map R1a1 Map. These three haplogroups probably arose between 20 and 30,000 years ago. Feb 25, 2014 - Y haplogroup J2 - and this one certainly has a high likelihood of being in my genome as well. Haplogroup G2. You must perform a Haplogroup Prediction before you are allowed to perform a Haplo-I Subclade prediction - and - your Haplogroup Prediction must predict your haplotype to be within Haplogroup. Haplogroup J2 has 2,176 members. Scientific Papers. Haplogroup K1b1a. The haplotypes of these Haplotype J2 Kohanim cluster under J2a4h (L24), not the J2a4b (M67) clade. Haplogroup J2 It is composed of several sub-Haplogroups representing several different countries like Turkey, Iraq, Kurdistan, Lebanon, Syria, Armenia, Georgia, Aegean, Balkan, Italy. Apache Log4j2 is an upgrade to Log4j 1. Introduction to Y. Other famous members of haplogroup G2a. In human genetics, Haplogroup J2 (M172) is a Y-chromosome haplogroup which is a subdivision of haplogroup J. April 4 · "NAI001 Late Xiongu J2a1h2-L25 SKT012 Early Xiongu J2a1h2-L25 TUH002 Late Xiongu J2a-M410 UGO001 Turk (Midievel. "The mutation defining haplogroup J is thought to have taken place some 45,000 years ago, probably in West Asia. Haplogroup J2 (M172) is a major subclade of Major Haplogroup J (P209). The Capelli study found J2 in modest proportions in Great Britain, ranging from zero in Ireland, the Orkneys, northern Scotland and the Hebrides - to 7 percent in Pitlochry. J2=25 9 Greeks IE (Greek) 110 9 17 I2a1=11 I2a2=2 I2*=2 I1=1 27 J1=6 J2=16 3 Greeks IE (Greek) 57 14. Tuesday, 29 March 2016. ftdna YBrowse ISOGG Y-SNP Subclade Predictor Morley Y-STR modal,GD,TMRCA McGee Y-STR TMRCA EHelix. One of the five Roman soldiers excavated at the York, England, archaeological site was haplogroup J2 (200 - 300 AD). Mar 21, 2014 - History and description of Haplogroup J (mitochondrial DNA) and its subclades. (Y-DNA / Y-chromosome, not to be confused with mtDNA J2). It is further divided into two complementary clades, J2a-M410 and J2b-M12. Haplogroup J is a human mitochondrial DNA (mtDNA) haplogroup. Seven Y chromosome major branches (E3b, G, J1, J2, Q, R1a1, and R1b) that are prevalent among Ashkenazi Jews. Advanced Search. ISRAELITE SAMARITAN-TRIBE OF LEVITE Abraham's Family Tree So, there are 7 Million mostly J2 and J1 in Israel 7 Million mostly J2 and J1 in the rest of the world and 3 Billion E1b1b1 Levites everywhere else. The expansion of both J2 and J1 is probaby associated with a nucleus in the South Caucasus and the northwestern mountains of Iran (Zagros), so they are basically local. Haplogroup J1 separated from haplogroup J approximately 31. save hide report. J2 Haplogroup YDNA hat 1. J2 is the modal haplogroup in a bunch of IE groups, R1b in another bunch, and R1a in yet another bunch. The most outstanding differences were observed in haplogroups J2 and R1, with the predominance of haplogroup R lineages in the Lasithi Plateau and of haplogroup J lineages in the more accessible. Recommended haplogroup research projects. Haplogroup J2 is thought to have appeared somewhere in the Middle East towards the end of the last glaciation, between 15,000 and 22,000 years ago. hg38 Position: ChrY:16645511. In 1998, Y chromosome of the chemist Sir John Anthony Pople, who won the Nobel Prize in Chemistry is a haplogroup J2b1 (J-M205) (Note 1). Transfer your YSEQ results to. We also develop web applications and build community (like J2TEAM Community). Haplogroup J2b1 is a branch on the maternal tree of human kind. Within the field of medical genetics, certain polymorphisms specific to haplogroup J have been associated with Leber's hereditary optic neuropathy. The clade spread from there during the Neolithic, primarily into North Africa, the Horn of Africa, Socotra, the Caucasus, Europe, West Asia, Central Asia, South Asia, and Southeast Asia. 99: Light T-Shirt $16. x that provides significant improvements over its predecessor such as performance improvement, automatic reloading. Ongoing research will likely show that the Haplogroup J population of northern Italy has a higher percentage of J2 than that of southern Italy. The main branch is J2a-M410, a higher frequency of this haplogroup is observed for Euboea (15. 722 BC: Assyrians conquered the (Northern) Kingdom of Israel/Samaria, and many Israelites were deported to Mesopotamia or other places of the Assyrian Empire. 7), and U2b2 (9. Similar to haplogroup N1b1, some mutations defining haplogroup J1 alter amino-acids with high conservation degree: (1) a transition in position 10398 which is a Thr114Ala replacement in the ND3 subunit of complex I, shown to alter mitochondrial matrix pH in cell-culture experiments ; and (2) a transition in position 13708, causing a Ala458Thr. Article Toward a Sephardic Haplogroup Profile in the New World - Free download as PDF File (. I'm from Beijing, China. A work in progress!!! Please feel free to make or suggest corrections and. 7), and U2b2 (9. Distribution. 5% of the population, the overwhelming majority of that being M410+ (J2a). Interestingly, we are moving into an era in which wholesale replacement of mitochondrial DNA throughout the body is a practical possibility. J2 Haplogroup 10th October 2014, 10:56 AM. org is the maternal (mtDNA) tree of humanity. It is estimated that J2 split first from J* around 37,000 years ago, followed by J1 some 33,000 years ago. But it is mostly associated with Northwest Asia. For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. Haplogroup D is found throughout Asia, into Europe and throughout the Americas. Z2215 Haplogroup. Haplogroup Q1a3a1 is one of the few Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas, along with haplogroup C3b-P39 which is almost exclusively found in North America. It is thought that J-M172 may have originated between the Caucasus Mountains, Mesopotamia and the Levant. Feb 25, 2014 - Y haplogroup J2 - and this one certainly has a high likelihood of being in my genome as well. This page was last edited on 17 November 2018, at 12:23. Theories include “selection for pigmentation traits which include UV expositor causing skin cancer, vitamin D deficiency, and also sexual selection. It is thought that this Haplogroup might have originated among the Caucasus Mountains, the Levant, and …. Haplogroup J is very common in the Middle East, where many Jews, Arabs, and others belong to it. To see the current charts, you need to go to the Haplotree tab on your FTDNA member page. Iniciar sesión. Y-DNA Haplogroup J2 Y-DNA Haplogroup K-M9 is an old line which arose about 50. Today, I want to present the haplogroup J1 tree with STR111 data. The R mtDNA haplogroup is a descendant of type N that originated about 66,000 ya in South Asia not long after the initial Out of Africa crossing. Haplogroups J/J2 Like haplogroups E3b and G, haplogroup J and its subclades originated in the Near East and spread across Europe and the Mediterranean during the Neolithic. Site Rating. See https://aka. The newly discovered haplogroup, Q1a3a4, designated by L400 and L401 is shown last on the list and is the new Native American haplogroup discovered thanks to Leonard Trujillo. Y-DNA was tested from Kurds from a Kurdish village called "Dogukoy" in the central Anatolian region they called "Yuksekyer" (the real village and region names were obfuscated). It is thought that J2 may have originated between the Caucasus Mountains, Mesopotamia and the Levant. An ancient genetic marker, known as haplogroup 1, was found in most Irish men. Y Haplogroup J. J2-M172 – Haplogroup Research, Y-DNA Info J2-m172. Quite a few ancient Mediterranean and Middle Eastern civilisations flourished in territories where J2 lineages were prevalent, such as the Etruscans, Minoans, Ancient Greeks, Phoenicians and Israelites. "Both the sub-branches of haplogroup J2-M172 (J2a-M410 and J2b-M102) are found in the two Greek regions. 5 The paper also suggests that Haplogroup subclades G2a3a-M406 and J2a4h-M530 are indicative of. View History. The "Cohen Modal Haplotype" is a specific set of six Y-STR marker values that occurs in both J1 and J2, though at a much higher frequency in J1. Distribution of Haplogroup J2 in Eurasia. T is found among 14% of those tested, followed by I with 6%, J with 4%, X2 with 3%, K with 2%, and W with. The time of origin of this haplogroup is estimated between 25,000 - 30,000 years BP, placing the Haplogroup I founding event approximately contemporaneous with the Last Glacial Maximum (period in the Earth's climate history when ice sheets were at their maximum extension). 4%) in the Saraiki and L2a (15. Advanced Search. Haplogroup J1 separated from haplogroup J approximately 31. Erle Stanley Gardner (July 17, 1889 – March 11, 1970) was an American lawyer and author, who belongs to haplogroup J2-Y66507. - Both the frequency and subclade diversity of Haplogroup J2-M172 (as well as the presence of J2*-M172 and J2a*-M410 across the country) makes Iran a strong candidate for the origin of this lineage. Spread of Y-DNA Haplogroup J1: Haplogroup J2 is defined by the M172 marker. ملف:Distribution Haplogroup J2 Y-DNA. Major branches are J2a and J2b. ISRAELITE SAMARITAN-TRIBE OF LEVITE Abraham's Family Tree So, there are 7 Million mostly J2 and J1 in Israel 7 Million mostly J2 and J1 in the rest of the world and 3 Billion E1b1b1 Levites everywhere else. Haplogroup G-M201,the origin and distribution of haplogroup G and subgroups over the world. In human genetics, Haplogroup J2 (M172) is a Y-chromosome haplogroup which is a subdivision of haplogroup J. FDLCA - 4 B-46. The following gradients can be found in the Balkan area: (1) There is a north-south gradient of R1b in the north of the Balkans: The frequency of R1b is about 25% in the Slovenes, but is considerably lower elsewhere and only about 2% in some. Cultural Anthropology of Y-DNA Haplogroup J2 +M172. [This product is no longer under support. Updated versions. R1a1 Map R1a1 Map. Moreover, there are two common subclades of U3. 8% I-M26, the "Sardinian" frequent y-haplogroup), 3% J2, 1. So, you see it is difficult to know which haplogroup is really Israelite. Haplogroup J2 is thought to have appeared somewhere in the Middle East towards the end of the last glaciation, between 15,000 and 22,000 years ago. Origins & History. For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. Ongoing research will likely show that the Haplogroup J population of northern Italy has a higher percentage of J2 than that of southern Italy. Haplogroup J is a human mitochondrial DNA (mtDNA) haplogroup. [1][9] "The main spread of J2 into the Mediterranean area is thought to have coincided with the expansion of agricultural people's during the Neolithic period. ftdna YBrowse ISOGG Y-SNP Subclade Predictor Morley Y-STR modal,GD,TMRCA McGee Y-STR TMRCA EHelix. Haplogroup J: Possible time of origin: 31,700±12,800 Years BP. In human genetics, Haplogroup J2 (M172) is a Y-chromosome haplogroup which is a subdivision of haplogroup J. 6%) and Tehran (15. png 2,063 × 2,138; 1. txt) or read online for free. Major branches are J2a and J2b. E1b1b – North Africa, Jews and South Europe in the same regions as J2, but especially Greece 27%and. 112 registered by Afilias Global Registry Services network. António de Macedo - born in Pico Haplogroup - J2. The people known as. What are the benefits for J2TD Token. We also develop web applications and build community (like J2TEAM Community). J2 (M172) está presente en el área mediterránea, [14] típico en poblaciones del próximo Oriente, en Irak 29. Samsung J2 Core J260F Combination file Free Download latest Bootloader J260F U1 J260F U2 This Combination firmware only can be use on Samsung J2 Core J260F J260 260 and android version. (Y-DNA / Y-chromosome, not to be confused. J2 y-Haplogroup (M172). 7 oranında çıkmıştı. Japan (18) J1 League J2 League J3 League Japan Football League Regional Leagues Emperor Cup J-League Cup Super Cup Play-offs 1/2. This blog is dedicated to those who carry the J2 "Y" DNA Haplogroup, with a focus on J2a4h2, also known as J-L25, with further changes to F3133, and FGC9962. ملف:Distribution Haplogroup J2 Y-DNA. The expansion of both J2 and J1 is probaby associated with a nucleus in the South Caucasus and the northwestern mountains of Iran (Zagros), so they are basically local. Current Haplogropup J2 distribution Most Yanceys are J2. In human genetics, Y DNA haplogroup J1, also known as J-M267, is a sub-haplogroup of Y DNA haplogroup J, along with its sibling clade Y DNA haplogroup J2. Di Giacomo et al. Click a thumb to load. See Y-DNA haplogroup projects for a full list of J2a projects. Transfer your YSEQ results to. Cultural Anthropology of Haplogroup J2. Discussion and support of Y-DNA. Maven is a build automation tool used mainly for Java projects. Elizabeth Caldwell Hirschman Department of Marketing School of Business Rutgers University New Brunswick, NJ 08903. Y-DNA Haplogroup J2 Y-DNA Haplogroup K-M9 is an old line which arose about 50. 7 oranında çıkmıştı. British haplogroup I at 15% (in Norway 30%) compares to Jewish J2 at 30%: I is another type of J. Seven Y chromosome major branches (E3b, G, J1, J2, Q, R1a1, and R1b) that are prevalent among Ashkenazi Jews. A single P279 haplotype (J2a3), an extremely rare sublcade of J2 was also observed. com/samsung-europe-region-firmware/88381-samsung-j260g-j2-core-u6-flash-file. This haplogroup is defined by the presence of the rs3894 (M3) single-nucleotide polymorphism (SNP). Haplogroup J2 is commonly found within Asia Minor, Persia, Central Asia and the Caucasus Mountains and is frequent in modern and historical inhabitants of the Levant and Fertile Crescent especially among Jews and in Lebanon. Cinnioglu et al. From Wikipedia, the free encyclopedia. Other Y-DNA haplogroups reaching considerable frequencies among the Burusho are haplogroup J2, associated with the spread of agriculture in, and from, the neolithic Near East, and haplogroup C3. G1 and G2 entered Europe in Neolithic times in several waves, together with J1 and/or J2. Haplogroup J2 is found mainly in the Fertile Crescent, the. Y-DNA Haplogroup Update U. 5% of the population, the overwhelming majority of that being M410+ (J2a). associated with Syrian neolithic; poss. us – Haplogroup J2 Sardarapat is a memorial complex, 38 Km west from Yerevan, erected in 1968 to commemorate the Armenian people’s victory over Turkish invaders in 1918. It's the second most frequent clade in the Levant after J1/J2. Haplogroup I spread up through central Europe and into Scandinavia, where it is well represented today. - A mtDNA Haplogroup Finder Click Here. Major branches are J1 and J2. 1) o Haplogroup J1 o Haplogroup J2 (M172) o Haplogroup J* Groups. Maven addresses two important aspects of software: how it's built and how its dependencies. Haplogroup J2 tiene 2. Note: J2 is not Semitic but Phoenician, which was a mixture of Semitic and Hamitic. António de Ávila - born c1700 in Lajes do Pico Haplogroup - J2. and among some Kushitic / Nubian Tribes and hamitic groups of sudan and ethiopia. The Haplotype frequency table quickly demonstrates that the level of M172, Haplogroup J2 is fairly evenly distributed througout Iran's geography and the population groups studied. The Phoenician-colony test results highlight only one haplogroup, J2, which consistently scores significantly in all three tests across the range of colonization sites. Transfer your YSEQ results to YFull. Documents for Y-Haplogroup J2a1b (J-M67) Mandel Project « Back to Y-Haplogroup J2a1b (J-M67) Mandel Project 260053 J2 Ancestral Journey eng. Many of the previously described eight sub. Infobox haplogroup name =J2 origin date =18,500 +/ 3,500 thousand years ago. 하플로그룹 Haplogroup J2 (Y-DNA) 무임축 체질 하플로DNA체질 / 체질의 무상판별. For all who are members of, or interested in Y-DNA haplogroup J2, made up of paternal-line descendants who share the M172 mutation. [Phylogenetics 2] Haplogroup J-M172 is common in modern populations in Western Asia, Central Asia, South Asia, Europe and North Africa. Distribution Haplogroup J2 Y-DNA. As shown in the chart, the polymorphism found to be most significantly related to longevity within J is C150T and as shown below, that polymorphism value is also an indicator for J2. 053 Mitglieder. Гаплогруппа j2 происходит от мутации гаплогруппы j, произошедшей у мужчины, жившего около 31 600 лет назад. Haplogroup J1 separated from haplogroup J approximately 31. Haplogroup J2 有 2,119 位成员。 For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. I was fed up to constantly see badly mistaken distribution maps of haplogroup J2 (the latest in date being from the Thangaraj et al. Worldwide subclade diversity and distribution of J2a-M410 suggest its spread from West and Central Asia into India through NW corridor ( Fig. Haplogroup J2 is a subclade of haplogroup J. YSEQ Haplogroup Predictor (beta) Predict your Y haplogroup from Y-STR alleles and find the YSEQ haplogroup panel that best fits your previous STR results. The frequency of this haplogroup in Europe ranges between 40-50%. All descendants will carry that mutation. "It turns out that Abraham evidently had three haplotypes - one in haplogroup J1, the second in haplogroup J2, and the third in haplogroup R1a. Note: J2 is not Semitic but Phoenician, which was a mixture of Semitic and Hamitic. The J2b haplogroup is descended from the J2-M172 haplogroup. svg מתוך ויקיפדיה, האנציקלופדיה החופשית קפיצה לניווט קפיצה לחיפוש. Forward Primer: FT131537_F GGGATTACAGGCATGAGCTG Reverse Primer: FT131537_R CAATTCAGAACCTGAAATAAATATCG. A second possibility could be a factor acting over many generations in a particular geographical region or population within which a haplogroup was frequent. Our paternal ancestors will also have the same signature. Haplogroup J2 is thought to have appeared somewhere in the Middle East towards the end of the last glaciation, between 15,000 and 22,000 years ago. [This product is no longer under support. Four of these (E3b, G, J1, J2, and Q) were part of the ancestral gene pool from the Middle East, whereas R1b and certain R1a sub-lineages are from Europe and may have incorporated into the Ashkenazi Jewish population. In fact, it is the most common Haplogroup found in Iran overall and in the above listed study, present in 28% of Iranian Arabs and 25% of the Bakthiari. A new haplogroup is born when a very specific new mutation occurs. associated with SUMERIAN language; CURTIN; COHEN, COHAN, KOHN, KAHAN). See full list on abroadintheyard. For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. Map of Haplogroup N in Europe. Below are Y-SNP calls for I1730, an early Bronze Age sample from the site of 'Ain Ghazal in Jordan. Haplogroup J2 有 2,119 位成员。 For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. Turkish people also has a 24% frequency of J2 in Turkey. Y Haplogroup J. I have long argued that haplogroup J2, associated with the early Neolithic expansions was also the PIE lineage par excellence, and this certainly supports this theory. 1,6 K J’aime. However, I am proving that the early settlers of America belong to haplogroup R1b1, and the they came from northwestern Europe, which is well over 80% R1b1, not the J1 or J2 groups of the Israelites, Jews and Arabs (Ishmaelites). (Y-DNA / Y-chromosome, not to be confused with mtDNA J2). These three haplogroups probably arose between 20 and 30,000 years ago. In human genetics, Haplogroup F (defining mutations M89, P14, and M213) is a Y-chromosome haplogroup. Information about Haplogroup J2 - Genetic Research Page. It seems to be carried around Mediterranean people, and I was wondering, where exactly does it originate?. 1, M304, P209, etc. Y-DNA Haplogroup J2 YouTube Channel. J-L24 (J2a4h) J2a-PF5197/Z2397. See full list on isogg. Spread of Y-DNA Haplogroup J1: Haplogroup J2 is defined by the M172 marker. 4% of all modern Iranians combined; with J2 making up 22. The J Haplogroup Administrators. Haplogroup R1b1a2 peoples (M269)- Celtic people, Epic Celtic Music. It is common among Semitic populations, and includes the Cohen Modal Haplotype - the paternal genetic legacy of the Jewish priestly class. J2 was found to be significantly higher among Dravidian castes at 19% than among Indo-European castes at 11%. ftdna YBrowse ISOGG Y-SNP Subclade Predictor Morley Y-STR modal,GD,TMRCA McGee Y-STR TMRCA EHelix. Haplogroup J-M172. Beyond that, it is somewhat mysterious. The defining binary polymorphism of the new subclade is a deletion event in the Y-STR marker, DYS455. For all who are members of, or interested in Y-DNA haplogroup J2, made up of paternal-line descendants who share the M172 mutation. Cinnioglu et al. They have subsequently spread as far east as Sinjiang in western China and as far west as. קובץ:Distribution Haplogroup J2 Y-DNA. Haplogroup J2 is widely believed to be associated with the spread of agriculture from Mesopotamia (Iraq and subclades of J2 Haplogroup. 0%) in the Makrani. y-ДНК гаплогруппа j2 определяется мутацией в snp маркере m172. FTDNA: J2-Middle East / Arab Project. We also develop web applications and build community (like J2TEAM Community). 1007/s00439-001-0660-8. Cultural Anthropology of Haplogroup J2. The X haplogroup appears to have entered America in limited numbers perhaps as long ago as 34,000 B. A maternal haplogroup is a family of mitochondrial DNA (mtDNA) that traces back to a single common ancestor. Follow their code on GitHub. Cultural Anthropology of Y-DNA Haplogroup J2 +M172. Haplogroup J2b1 is a branch on the maternal tree of human kind. According to the Greek legend Europa’s brother Cadmus went looking for his kidna. انا ارى السلاله J1 و السلاله J2 شقيقتان بغض النظر عن من يتكل بها من الشعوب و بغض النظر. However J2 is not Semitic and should not be confused or combined with J1. J2: rs2032604 (M172) G T G J2a: N/A; J2a Projects. https://en. Map of haplogroup Q in Europe. J2-M172 is a predominant HG in West and Central Asia. 089 membros. тњIs̲ αςςΘǚит ḞΘя ωњΘ яǝḞǝяs̲ тΘ J̨̐2Ь1 њαρl̲ΘĠяΘǚρ. 하플로그룹 Haplogroup J2 (Y-DNA) 무임축 체질 하플로DNA체질 / 체질의 무상판별. One of only 24 people to have flown to the Moon, he orbited it…. 15% amongst Sephardic Jews. The Zadok Cohanim lineage is composed by 24 families strongly associated to Jewish priest caste, both in Ashkenazim and Sephardim communities. It is thought that J-M172 may have originated between the Caucasus Mountains, Mesopotamia and the Levant. Distribution of Haplogroup J2 in Eurasia. Y-DNA Haplogroup J2 YouTube Channel. Haplogroup J2. As a result of the technical analysis made, many technical information of m172. The frequency of haplogroup J (13. Our paternal ancestors will also have the same signature. This indicates, for example, a high prevalence of gene marker M172 (Haplogroup J2), shared by peoples (including Sicily's Elymians, Carthaginians, Greeks and Arabs) having remote origins in the Fertile Crescent. "The Neolithic control section shows nonsignificant results across all haplogroups, except for a significant J2 result in one test. DNA revealed families from different Cohanim background with the precisely coalescence time allied, in J2 haplogroup, to Zadok. I used the same method as before. Theories include “selection for pigmentation traits which include UV expositor causing skin cancer, vitamin D deficiency, and also sexual selection. These three haplogroups probably arose between 20 and 30,000 years ago. Also, the test shows that I have 2. Evidence from case studies is presented that allows the definition of a new subclade of Y Haplogroup J2b-M102. svg اذهب إلى التنقل اذهب إلى. More fascinating is the finding that the main haplogroup distinguishing the northern Indian brahmins from the lower castes is J2 (referred to as HG9). 4%), and in Persians of Yazd (17%). T2a Haplogroup T2a Haplogroup. The website is created in 21/12/2013 , currently located in Germany and is running on IP 85. The J Haplogroup Administrators. Haplogroup J2 originated in the northern portion of the Fertile Crescent particularly in Anatolia where it later spread into Europe during the Neolithic period (~5,000 years ago)and throughout central Asia, the Mediterranean, and south into India which saw the spread of soil cultivation, crop production and the raising of livestock. بلاد كنعان. J2: rs2032604 (M172) G T G J2a: N/A; J2a Projects. Cultural Anthropology of Haplogroup J2. Usually listed SNPs are checked for genome-seq-uniqueness with BLAT using ybrowse FastaDumper (since late 2017 hg38 / use Chrome/ium: ISOGG 500bp, SangerSeq 1kbp; ) and YFull SNP search (see Spreadsheet>Phylo-SNPs for details including. The R subhaplogroups are attributed to repeated ancient human. 0 heatmap analysis - Rhineland, Romans. The X haplogroup appears to have entered America in limited numbers perhaps as long ago as 34,000 B. In his book The Seven Daughters of Eve, Bryan Sykes named the originator of this mtDNA haplogroup Jasmine. Origin and Post-Glacial Dispersal of Mitochondrial DNA Haplogroups C and D in Northern Asia. "It turns out that Abraham evidently had three haplotypes - one in haplogroup J1, the second in haplogroup J2, and the third in haplogroup R1a. Files are available under licenses specified on their description page. Transfer your YSEQ results to YFull. In human genetics, Haplogroup I (M170, P19, M258) is a Y-chromosome haplogroup. Some log4j2. We've already received correspondence from a number of readers about their own results from genetic analysis. Y-DNA Haplogroup J and its Subclades - 2018. See full list on familypedia. 1007/s00439-001-0660-8. It is the most prominent haplogroup in Europe at ~50% and the United States at ~42%. Origins & History. White T-Shirt $19. 2017 Today, I want to present some Kurdish tribes Y-DNA haplogroup results across the Kurdistan. Manuel Cardoso de Azevedo (pai incógnito) - born 1835 Ribeiras, Pico Haplogroup - J2. Turkish people also has a 24% frequency of J2 in Turkey. It is further divided into two complementary clades, J2a-M410 and J2b-M12. Samsung Galaxy J2 Core (SM-J260AZ). See full list on eupedia. Intriguingly, Malaspina et al. I may be slow to respond. 21 comments. hierarchical Haplogroup name is used for Simple Tree output and sorting: check for correctness 12 used 2-3 SNP names should be the most known and available for sanger sequencing and in chip tests. Out of the 31 samples of this study, 16 are male, and with sufficient Y-chromosome coverage for haplogroup assignment (Table S2). These chromosomes all belonged to the J2-M172 clade of the Y-chromosome phylogeny, and in the latest phylogenetic revisions, they are now termed as J2a1. J2 haplogrubu hakkında bilgi içeren yazı, J2 nedir ve nerelerde görülür, J2 nin görülme oranları, haplogroup J2 map ve J2 geni hakkında bilgi, m172. Haplogroup J2. J2 is the modal haplogroup in a bunch of IE groups, R1b in another bunch, and R1a in yet another bunch. Haplogroup J (Y-DNA) J is Originally from Eastern Anatolia, divided into the northern J2 and the southern J1. For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. Are there any fees to use this service? There is a one-time fee of 0. The global distribution of J2-M172 sub-haplogroups has been associated with Neolithic demic diffusion. See also haplograph. ↑ Comparative chronological tree of European Y-DNA & mtDNA haplogroups. G1 and G2 entered Europe in Neolithic times in several waves, together with J1 and/or J2. "The Neolithic control section shows nonsignificant results across all haplogroups, except for a significant J2 result in one test. 0 J2b2 and Roman settlements at the Rhine frontier (Limes). Cultural Anthropology of Haplogroup J2. 1%), in the Mestizo population of Nicaragua is also evident, it being the second major Eurasian haplogroup found. Our Great Britain-6 member is of haplogroup J-M172 (also called J2) which has a distinctly Middle Eastern and Mediterranean population distribution, representing up to 30% of males in parts of Italy as shown below. In 1998, what is probably the most famous case of DNA-analysis was resolved with a Y. Many Middle Eastern populations have rates of J2 that are numerically and percentage wise much higher than European populations, where it is observed at. Haplogroup J2 also has been observed in a sample of Evenks collected in Olenyoksky District, Zhigansky District, and Ust-Maysky District of Yakutia (7/125 = 5. Haplogroup J2 is thought to have appeared somewhere in the Middle East towards the end of the last glaciation, between 15,000 and 22,000 years ago. They present a DNA signature in J2 haplogroup that formed a well shaped. From Wikimedia Commons, the free media repository. Discussion and support of Y-DNA. Although Haplogroup J1 (J-M267) is more common in Caucasia and Middle East, it is possible to see this haplogroup among Turkic people. Similar to haplogroup N1b1, some mutations defining haplogroup J1 alter amino-acids with high conservation degree: (1) a transition in position 10398 which is a Thr114Ala replacement in the ND3 subunit of complex I, shown to alter mitochondrial matrix pH in cell-culture experiments ; and (2) a transition in position 13708, causing a Ala458Thr. NJ219-E-TVP2-J20AA. Within the field of medical genetics, certain polymorphisms specific to haplogroup J have been associated with Leber's hereditary optic neuropathy. Haplogroup J2 is a subclade of haplogroup J. ftdna YBrowse ISOGG Y-SNP Subclade Predictor Morley Y-STR modal,GD,TMRCA McGee Y-STR TMRCA EHelix Y-STR Hg Predictor NEVGEN Y-DNA Tools Felic C. In 1998, Y chromosome of the chemist Sir John Anthony Pople, who won the Nobel Prize in Chemistry is a haplogroup J2b1 (J-M205) (Note 1). Z2215 Haplogroup. The J Haplogroup Administrators. Haplogroup J2 (M172) is a major subclade of Major Haplogroup J (P209). Some Israelite STR markers were identified in J2 such as a limited amount of Kohenim. S Tested with Log4j 2. The J-M172 haplogroup, also called J2-M172, is an ancient haplogroup estimated as first appearing 24,000 to 19,000 years ago but perhaps earlier. J2-M172 is a predominant HG in West and Central Asia. The authors suggest that there is a positive selective force to select for blue eyes in this region. Men with this type of Y DNA share a common paternal ancestry, which is demonstrated and defined by the presence of the SNP mutation referred to as M267, which was announced in Cinnioğlu et al. April 4 · "NAI001 Late Xiongu J2a1h2-L25 SKT012 Early Xiongu J2a1h2-L25 TUH002 Late Xiongu J2a-M410 UGO001 Turk (Midievel. If you look at this page for instance: Haplogroup J2 (Y-DNA). MtDNA sequences and Y‐chromosome STR haplotypes revealed decreased variation in some Aromun populations. Haplogroup J is a human mitochondrial DNA (mtDNA) haplogroup. J2a-M410(xM67) was the most frequent haplogroup subclade observed. J2 is by far the most common variety in Europe. A second possibility could be a factor acting over many generations in a particular geographical region or population within which a haplogroup was frequent. Click a thumb to load. Haplogroup I1 is a sub-type of haplogroup I occurring at greatest frequency in Scandinavia, associated with the mutations ( SNP s) identified as M253, M307, P30, and P40. Map of Haplogroup A-M91 Frequency range: 0% to 1%. Our "Y" Chromosome is inherited from father to son. Spread of Y-DNA Haplogroup J2: J2 Distribution: Distribution of Haplogroup J2 in Europe and Mediterranean basin: Distribution of Cardial Pottery corresponds with that of Hg J2:. Haplogroup J-M304 is divided into two main subclades (branches), J. and fry their brains until they are toast The Five Is work together and run the Q operation now. The nomenclature is based on ISOGG 2010: J2 M172, L228 • • J2* - • • J2a M410, L152, L212. In human genetics, Haplogroup J-M172 or J2 [Phylogenetics 1] is a Y-chromosome haplogroup which is a subclade (branch) of haplogroup J-M304. Some log4j2. The J Haplogroup Administrators. Haplogroup Mode predicts, based on the first three panels of markers, your Haplogroup or Subhaplogroup. [Phylogenetics 2] Haplogroup J-M172 is common in modern populations in Western Asia, Central Asia, South Asia, Europe and North Africa. This includes Hittites, Hattians, Luwians, Sumerians, Mitannians, Hurrians, and Kassites. The small hotspot in North West Europe on the left in the J2b2 map seems to be situated around the now French town of Bologne-Sur-Mer, in Roman times known as Gesoriacum, the port Portus Itius was believed to be situated there. 8 others=4 I1=8. For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. Haplogroup J2. This question requires a clear and in-depth Knowledge base and Understanding of the Haplogroups J1, J2a and J2b (from I-J Timeline) as depicted on EACH individual Phylogenetic Tree. Haplogroups are mtDNA sequence polymorphism variations that have occurred over more than 150 000 years and correlate with the geographic origins of populations traced through the maternal lineages. MT DNA or mitochondrial haplogroup is a signature that passes from mother to offsprings and Y chromosome DNA haplogroup is marker that passes from father to offsprings. Haplogroup I1 Haplogroup I2 Haplogroup J1 Haplogroup J2. Overall Haplogroup J comprised 31. Haplogroup J2 is widely believed to be associated with the spread of agriculture from the northern Haplogroup J2 is found mainly in the northern Fertile Crescent, the Mediterranean (including. According to the Greek legend Europa’s brother Cadmus went looking for his kidna. [1][9] "The main spread of J2 into the Mediterranean area is thought to have coincided with the expansion of agricultural people's during the Neolithic period. The Huguenots of France (R1b1) tended to live in French-speaking communes like Manikantown, Virginia. ISRAELITE SAMARITAN-TRIBE OF LEVITE Abraham's Family Tree So, there are 7 Million mostly J2 and J1 in Israel 7 Million mostly J2 and J1 in the rest of the world and 3 Billion E1b1b1 Levites everywhere else. Haplogroup E1b » Haplogroup J2 » Haplogroup R1b » Haplogroup R1a » Y-DNA Haplogroup > Haplogroup I1a. This haplogroup is defined by the presence of the rs3894 (M3) single-nucleotide polymorphism (SNP). See full list on eupedia. ↑ 2,0 2,1 Haplogroup R1b (Y-DNA). 8 MB Frequency and variance distributions of haplogroup J lineages. The J2 subclade of Haplogroup J (see entries at Wikipedia and ISOGG) arose in the northern Fertile Cresent, roughly 18,500 ±3500 years ago. One sub Haplogroup M172* is mainly found in the Northern Fertile Crescent, the Mediterranean, Iran, Central Asia, and Southern Europe. Info about Y-DNA J-M172 (J2) Haplogroup and Research. bence r1b haplogroup'u şuan %60-65 oranında çıkar, türkiye'de ki tüm etnik türkler de yapılsa. Remember a minimum of three markers is required. Q3-L275 by Gioiello » Thu Feb 09, 2017 5:11 pm Last post Last post by dartraighe Wed Jun 19, 2019 7:48 pm 6 Replies Replies 4071 Views Views; Q Haplo Project - waiting for update. Гаплогруппа j2 происходит от мутации гаплогруппы j, произошедшей у мужчины, жившего около 31 600 лет назад. Y-DNA Haplogroup J and its Subclades - 2018. [Phylogenetics 2] Haplogroup J-M172 is common in modern populations in Western Asia, Central Asia, South Asia, Europe and North Africa. It is found in major parts of Asia, (Western, Central, and South), in Europe and North Africa as well. They present a DNA signature in J2 haplogroup that formed a well shaped. J2 was found to be significantly higher among Dravidian castes at 19% than among Indo-European castes at 11%. April 4 · "NAI001 Late Xiongu J2a1h2-L25 SKT012 Early Xiongu J2a1h2-L25 TUH002 Late Xiongu J2a-M410 UGO001 Turk (Midievel. Haplogroup H showed a 30% higher intrinsic mitochondrial function compared with the other haplogroup U. Some log4j2. William Welles Hollister. 하플로그룹 Haplogroup J2 (Y-DNA) 무임축 체질 하플로DNA체질 / 체질의 무상판별. Interestingly, we are moving into an era in which wholesale replacement of mitochondrial DNA throughout the body is a practical possibility. Origins & History. Haplogroup J2 is widely believed to be associated with the spread of agriculture from Mesopotamia. Haplogroup A2 is an Native Americas branch on the maternal tree of human kind. Haplogroup H is the most frequent haplogroup in both Europe and the Near East but occurs at frequencies of only 25%30% in the Near East and the Caucasus, whereas the frequency is generally 50% in European populations and reaches a maximum of 60% in the Basque country. Haplogroup G, like haplogroups E3b and J2, is thought to have originated in the Middle East, and to have spread into Europe during the Neolithic. Quite the same Wikipedia. Haplogroup J2 (M172) is a major subclade of Major Haplogroup J (P209). Y-DNA Haplogroup J2 YouTube Channel. William Welles Hollister, a famous Californian rancher, belonged to Y-DNA haplogroup R1a1. Haplogroup Choose a Haplogroup for the PhyloTree and MSeqDR Annotations, or Type in Searchbox: 1. But what is generally unknown is that he belongs to an exceedingly uncommon mitochondrial haplogroup, J1c2c3. It is maintained by Dr. Just better. Within the field of medical genetics, certain polymorphisms specific to haplogroup J have been associated with Leber's hereditary optic. xml examples, just for self-reference. Intriguingly, Malaspina et al. This haplogroup is the roo;t of all living human Y-DNA haplogroups except for haplogroup A. Haplogroup J2-M172 in Iran A 2008 Paper written by Nasidze et al, Close Genetic Relationship Between Semitic speaking and Indo-European speaking Groups in Iran, works to demonstrate that geography plays a much stronger role than language in determining genetic relatedness. Other European Y-DNA haplogroups include Haplogroup N2 (Finland and Russia), Q (Norway), G (central and southern Europe), J2 (the eastern Mediterranean and Ashkenazi Jews), and T. 5% of the population, the overwhelming majority of that being M410+ (J2a). The R subhaplogroups are attributed to repeated ancient human. It is thought that J-M172 may have originated between the Caucasus Mountains, Mesopotamia and the Levant. In Human Genetics, J2 haplogroup (AKA J-M172) is among the most frequent Y DNA haplogroups in the Middle East and in the Arab World. A significant association was observed between the 11778/ND4 mutation and both haplogroups J1 and J2 and between the 14484/ND6 mutation and haplogroup J1. He belonged to haplogroup J2b-L283. Discussion and support of Y-DNA. See full list on familypedia. YSEQ Haplogroup Predictor (beta) Predict your Y haplogroup from Y-STR alleles and find the YSEQ haplogroup panel that best fits your previous STR results. 4% of all modern Iranians combined; with J2 making up 22. Other famous members of haplogroup G2a. Information about Haplogroup J2 - Genetic Research Page. yDNA haplogroups are used as genetic markers - in tracing the ancestry of male individuals to L may have been (with the exception of J2) the original Y haplogroup of the creators of the Indus. 7% Balkan which is quite amazing. Looking at the Y-DNA haplogroup frequencies by country it is easy to assume that J1 is a marker of Arabic ancestry because J1 reaches its maximum frequency in and around the Arabian peninsula. For anyone scientifically interested in paternal lineage J2, J2a, J2b, etc. Z2215 Haplogroup. The phylogenetic derivation of J2a-M410 from its ancestral J-M304 haplogroup is: J-M304 > J2-M172 > J2a-M410. svg מתוך ויקיפדיה, האנציקלופדיה החופשית קפיצה לניווט קפיצה לחיפוש. This indicates, for example, a high prevalence of gene marker M172 (Haplogroup J2), shared by peoples (including Sicily's Elymians, Carthaginians, Greeks and Arabs) having remote origins in the Fertile Crescent. haplogroup j2, yahudiler israillier de bulunan haplogrup tur. (2004), Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe (PDF; 245 kB) Human Genetics 115 357–371 Sanchez et al. Spread of Y-DNA Haplogroup J1: Haplogroup J2 is defined by the M172 marker. One of only 24 people to have flown to the Moon, he orbited it 74 times in the command module (CM) Endeavour. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. 3 J-PF5172 estimates the TMRCA to 14,300 years. [This product is no longer under support. New comments cannot be posted and votes cannot. Updated versions. R1a1 Map R1a1 Map. ] The Microsoft Visual J#™ Redistributable Package version 2. Use the legend for. Now about 2,5 % of the World population has this haplogroup. Haplogroup J-M304 is divided into two main subclades (branches), J. (Y-DNA / Y-chromosome, not to be confused with mtDNA J2). Cultural Anthropology of Haplogroup J2. (Excerpted from Genebase. The J Haplogroup Administrators. Haplogroup J itself splits into J1-M267 and J2-M172, which in term fractionate into the numerically dominant J1e-Page08/P58 and J2a-M410 clades (Chiaroni et al. Quite the same Wikipedia. These three haplogroups probably arose between 20 and 30,000 years ago. This thread is archived. For 18 years J2 Scientific has focused on automating the prep lab. 1-1 of 1. Transfer your YSEQ results to. Y-haplogroup E originated in Africa. Think of a haplogroup as an ancestral clan, a large family, like the Celts, or Vikings. The Phoenician-colony test results highlight only one haplogroup, J2, which consistently scores significantly in all three tests across the range of colonization sites. It appears at low frequencies (2-4%) also in the Northern part of the Middle East (Iran, Turkey, Armenia, Kurdistan, Lebanon, but much less among Arabs) and perhaps in Central Asia (Tajikistan and Uzbekistan, though these regions have not been well tested). 121 miembros. png 2,057 × 1,377; 1. Haplogroup J-M172 is common in modern populations in Western Asia, Central Asia, South Asia, Europe and North Africa. 500 years ago. org minimal reference J2 YTree YFull J2 Composite Y tree – Ray Banks J2 Draft ytree. Haplogroup J2 tiene 2. hierarchical Haplogroup name is used for Simple Tree output and sorting: check for correctness 12 used 2-3 SNP names should be the most known and available for sanger sequencing and in chip tests. These three haplogroups probably arose between 20 and 30,000 years ago. Many Middle Eastern populations have rates of J2 that are numerically and percentage wise much higher than European populations, where it is observed at. I used the same method as before. In human genetics, Haplogroup I (M170, P19, M258) is a Y-chromosome haplogroup. Other famous members of haplogroup G2a. Haplogroup J2 is thought to have appeared somewhere in the Middle East towards the end of the last glaciation, between 15,000 and 22,000 years ago. target all J2. In human genetics, Haplogroup J-M172 or J2 is a Y-chromosome haplogroup which is a subclade (branch) Haplogroup J-M172. The time of origin of this haplogroup is estimated between 25,000 - 30,000 years BP, placing the Haplogroup I founding event approximately contemporaneous with the Last Glacial Maximum (period in the Earth's climate history when ice sheets were at their maximum extension). Haplogroup M is most prevalent in Melanesia. J2 haplogrubu hakkında bilgi içeren yazı, J2 nedir ve nerelerde görülür, J2 nin görülme oranları, haplogroup J2 map ve J2 geni hakkında bilgi, m172. FTDNA: Deepclade Haplogroup Tests. 7% Balkan which is quite amazing. This can be interpreted to mean that Abraham was a collective figure, although his lifetime coincides with the Biblical descriptions and interpretations of the Jewish sages. It's certainly native to the Near East, where all of the main subclades of Y-haplogroup J2 show more structure than anywhere else.